PLUGGAR!

Pluggar SO nu. Kan inte blogga. Headern är fixad btw!
Nån mer som ska plugga? plugget hit och plugg dit :D plugga till de här då! :)

VILLE BARA HA NÅTT ATT GÖRA I 10 MIN. NU ÄR JAG REDO FÖR PLUGG.. :(

Vad gjorde du kl 08 imorse: Satt i skolan.

Vad gjorde du för 15 min sedan: Försökte plugga..

Det sista du sa högt: "försökte plugga"

Det senaste någon sa till dig: ”Okej"

Vad har du druckit idag: vatten, juice och cola

Vad var det senaste du åt: mat.

Vad var det senaste du köpte: I don't know.

Vad är det för färg på din ytterdörr: vit

Vad är det för väder hos dig nu: kallt typ?

Godaste glassmaken: åhhh vet inte! :o

Tror du på kärlek vid första ögonkastet: både ja och nej.

Sover du tungt: om jag är trött, ja

Drömmer du mardrömmar: kan hända.

Trivs du med ditt jobb: -

Favoritklädsel: Adidas bralls, Skön tröja typ :D

Favoritlåt just nuTom Dice – Me And My Guitar

Vad ser du om du tittar till höger: Ulrik <3

Vad gör dig glad just nu: musik!

Vad ska du göra härnäst: plugga bajs SO.

Höger eller vänsterhänt: höger

Humör just nu: "vill-inte-plugga-humöret"

Kläder just nu: Adidas bralls, skön tröja, t-shirt, osv.

Sommarplaner: åka till turkland, ha allmänt kul! :D

Hur många kuddar sover du med: dos!

Favoritgodis: typ allt.
Har du pojkvän/flickvän / på g: nejnej.

Spelar du något instrument: njeaee, asså jag kan ju men jag spelar ju inte för de

Morgon eller nattmänniska: nattmänniska!
Vad är viktigast för dig: människor, mat, musik.

Är du kittlig: yes sir!

Snarkar du: ibland säkert.

Äckligaste insekten: kackerlackor, spindlar allt vafaan!


LISTA LITE SÅHÄR I SKOLAN!

Klädsel
Vad har du på dig idag:
Converse, strumpor, jeans, trosor, t-shirt, bh, tröja!
Vad använder du just nu för skor: Converse!
Favoritfärg på kläder: svart, blå,vit och grå!



Senaste person som
Sov i din säng:
jag.
Du pratade med: Anna
Du delade en drink med: Idk.
Du gick på bio med: cotten
Du gick på stan med: morsan.
Du sov tillsammans med: Aston..
Du tyckte om mer än bara vän: deru!
Skällde på dig: morsan säkert.
Såg dig naken: ingen


Senaste
Låt du hörde:
Kommer inte ihåg.
Film du såg: The holiday!
Mat du åt: fisk in the school..
Kram: Lilly.
Puss: -
Fest: idk.
Ligg: -
Känslan: "oboyyyyy måste ha oboyy!!!!"
Ilska: vet innnnnnteee
Resa: england
Glädje: haha klassens humor!
Dröm: kommer inte ihåg
Boken du läste: cirkusflicken som suger.
Personen du träffade: alla i skolan
Personen du pratade i telefon med: kissen
Personen du fick sms av: orkar inte kolla
Personen som sa att han/hon tyckte om dig mer än vän: -
Gången du åt en 7-eleven korv: -
Gången du var utomhus: nyss
Gången du sov: inatt
Gången hela din familj åt middag tillsammans: vafaannn....... helgen?
Saken du köpte: mat


Om dig

Namn: Therese
Ålder: 13
Smeknamn: Tess, tessan tyyyp
Syskon: brorsaaaan
Sysselsättning: jag hoppar den..
Bra egenskaper: men sånt är ju skit svååårt.
Dåliga egenskaper: ggggger upp för lätttt!
Linje/klass: 7an
Hårfärg: blond
Ögonfärg: blå-grå
Skostorlek: 37

ÄLSKADE SHORTS! ♥

Min kära moster och morfar var och "shoppade" idag. Oså kom hon nyss hit med dom här godingarna! Från Gina Tricot 349 :- Och jag behövde inte betala nånting! Fick en grå tröja oxå! Den fanns inte på deras hemsida men den va oxå snygg! :D Tack :D ♥

FLYTTAT ARSLET UPP TILL SÄNGEN!

Har legat på soffan hela dagen! Kollat på film, tappat en hel RISTORANTE pizza på golvet uppochner, ätit kakor, choklad.. jag är så jävla hungrig hela tiden när jag är hemma och sjuk. Hade jätte lite feber imorsse. Men de gick över sen! :) So tomorrow i'm back in school! Nu ska jag plugga SO. Prov på torsdag :c wohooo.. See ya later.

JAG TAPPADE PIZZAN! :'(

Nu har jag INGETALLS att äta. faaan D'''''':

LITET SNABBT INLÄGG DIRR FRÅN SOFFAN.

Hej är hemma idag! Sov typ hela dagen igår. Efter min pw och dusch och lunch så sov jag ett tag. La mig på soffan engång till sen. Orkade ingenting! Känns inte så mycket bättre idag heller.. Så jag ligger i soffan och kollar på film! Finns typ inget att äta så jag vill helst dö. :( Hörs imon eller nått!
skulle inte vara helt fel!

POWERWALK!

Kom nyss hem efter en powerwalk till mormor. På hemvägen fick jag med mig en liten Aston i vagnen. Sjukt skönt att komma ut lite! :D Nu ska jag duscha innan alla kommer hit igen! BYE.
Inte idag.

HÅLLER PÅ ATT FIXA HEADER!

Är så trött på den som jag har nu! Alla borde ju vara det! Men såhär kanske den kommer att se ut.
Nått sånt! :)

SOVA!

Somnade 11 (!!!!!!!!!!!) igår! Hur skönt som helst! Vi satt och kollade på film oså fick jag bara ett ryck och gick upp och la mig! Sa ingenting bara gick. Oså vaknade jag nu. Eller först vaknade jag ju nån gång när de va skit mörkt i mitt rum. Hade slängt ner täcket på golvet.. men sen vaknade jag halv nio, men nej somnade om till tio! Fan va skönt! :D

WTF?!


TACOSPAJ OCH CHEESECAKE!

När jag kom hem från backen började jag göra citron cheesecake! Sjukt gott det blir! Hade nyss ut degen till tacospajen. Jag är sååå hungrig! :( Har inget att göra heller. Jaja.. hörs!
Snygg "krans" ...

JAG FÖLJER MED DIG HEM IKVÄLL FÖR JAG VILL INTE VARA SJÄLV

Gomorron! Vaknade halv nio av ett sms. Jag tror jag typ sa "ojj nu ringer det" i sömnen. Sen var det kört att somna om! Men det var rätt så skönt att vakna i tid.
Nu måste mamma bara åka till ica så jag får nå frukost nångång. Vid 12 ska vi grilla korv och åka pulka! Så det blir väl kul!
Helt sjukt! Jag har inte  åkt pulka eller skidor i år! Eller där vid jul heller. Har ju inte varit nå snö. Oså vet jag inte riktigt vart dom tog vägen när vi skulle börja bygga garaget (stavning?!) Hörs mer ikväll :)

DAGENS LÅT

Börjar inlägget med DAGENS LÅT : Veronica Maggio – Mitt hjärta blöder - Walz Guld Remix Sjukt bra!
Hej! Har varit hos morfar hela kvällen. Skjustade hem brorsan typ vid 6 kanske. Jag följde med hem och tog med datorn, så jag kunde fortsätta bygga om massa på Sims.. :$ jag är rätt så säker på att jag vill bli inredare nu iallfall.
Kom nyss hem, böt om, skönt! Och nu ska jag läsa lite bloggar och lyssna på musik sen kanske kolla lite på film!
Imon så ska vi grilla korv och åka pulka nånstans! Vet inte vart med det får vi se :)
Har typ inget mer att skriva. Hejdå och gonatt! :)
Jag vet inte...

KÖR PÅ EN LISTA

- Tio frågor om dig själv
Vad heter du i andranamn? - Ellinor -.-
Har du några piercingar? vart? - Öronen om de räknas?
Sover du hellre ensam än tillsammans med någon? - Beror på..
Väljer du filmkväll framför utekväll? - Japp :)
Vad tycker du om med dig själv? Snäll, är kanske för snäll ibland..
Är du dag eller nattmänniska? - Båda!
Vad har du på dig just nu? - Adidas bralls, T-shirt, tröja, bh och trosor!
Är du nöjd med ditt utseende? - duger.
Vad vill du ändra med ditt utseende? - Näsan och låren

- Tio frågor om kärlek
Är du i ett förhållande just nu? - Nej :)
Har du varit kär på riktigt någon gång? - Ja :)
Tror du på kärlek vid första ögonkastet? - Jarå..
Hur många har du varit riktigt kär i? - Jag blir kär för lätt.. så kan inte riktigt räkna, eftersom att man tycker alla sina ex är idioter.
Vad för sorts killar faller du för? - Killar med klädstil, charmiga, roliga, snäll, omtänksam, HÅRET!!! ögonen och munnen oxå såklart! Helst hela paketet om man säger så! Alltså inte badboys ;)
Har du kysst en kompis någon gång? - Ja...fast en kill kompis dårå!
Hur många har du varit tillsammans med? - Palla hålla koll på de? ;o

- Tio frågor om dina vänner
Vem vet allt om dig? - Agnes och ingen annan än Agnes!
Vem skulle du vilja träffa just nu? - Agnes!
Vem saknar du mest just nu? - ;)
Vem krama du senast? - Jadu.... kommer inte ihåg
Vem står dig närmast? - Agnes
Vem är mest partyprisse? - Haha... jadu...
Vem ringer du när du är ledsen? - Agnes ofc!

- Farligheter
Snusar du? - Nej
Har du snott något från en affär någon gång? - No
Brukar du röka? - fan eller!
Har du tagit droger? - Nej
Känner du folk som tar droger? - Tror inte de.
Har du blivit jagad av polisen? - hahaha
Har du druckit så mycket att du spytt? - nopp
Dricker du alkohol varje helg? - Nej dricker aldrig
Skulle du kunna testa droger? - nepp
Skulle du dumpa din pojkvän om han sa att han går på droger? - ja
Har du varit i slagsmål någon gång? - nej.

- Random
Sover du med dörren öppen eller stängd? - stängd.
Har du kysst ett ex efter att ni gjort slut? - kanske?
Tror du två ex kan vara vänner? - hahaha jaa..
Skulle du vilja vara berömd? - Nej fan va jobbit!
Har någon sett dig i underkläder de senaste två dagarna? - inte vet jag.
Brukar du tänka innan du talar? - nejj.
Känner du någon som är oskuld? - Men hallå?!
Skulle du vilja tatuera dig? vars? - Magen, Armen, ryggen och benet :D
Har du någon av motsatt kön du kan berätta allt för? - HADE.
Skulle dina föräldrar bry sig om du kom hem efter fyra på morgonen? - Om de skulle hända nu skulla jag vara rätt så död, så ja..
Tror du andra tycker illa om dig? - Yes.

RAGGE FTW!

Så jävla skön! Kom nyss hem. Riktigt skön dag! 4 lektioner innan lunch och två efter sen slutar man! Sjukt skönt :) Nu ska jag chilla innan vi ska dra ner till morfar ikväll! :)

RAST

Tjaooohaao
Har rast. Chill ;)
Majjssan! :**** "aatititiiititititiiiititititiititaahhtitiititiiii"

YOU JUST WANT ME WHEN I'M TAKEN

Städa rummet : check!
Kollat på Dubbelliv : check!
Kolla klart på 17 again : ska nu! ;)
Dubbelliv var så bra idag! Längtar redan till nästa torsdag! :D
Kan ta lite snabbt vad som händer i helgen!
Fredag : skola, hem, hem till morfar, för han kommer hem då! vara där oså.
Lördag : Kissen och ungarna är ute så är väl med dom och morfar, kanske åka pulka i backen? :)
Söndag : Om jag kommer ihåg att ta hem SOn så ska jag plugga de lite. Och då är säkert alla här -.-
Så ser min helg ut! Inte en ledig dag...
Nu film sen sova! Gonatt
sommar outfit!

GRÅTER MAN INTE AV SORG, GRÅTER MAN AV GLÄDJE!

Pratar i skype med Agnes och lägger in bilderna jag va ute och tog för ett tag sen! Men nu börjar jag bli hungrig så jag kanske ska börja med mat? :)

so fuckin' true! :D


GLÖM IDAG LEV IMORGON!

Hej! Är på mycket bättre humör! Grinade en timme och nu känns allt mycket bättre! Allt försvinner ju inte bara för de. Men de kan iaf kännas jävlit mycket bättre! Ikväll är det dubbelliv så jag riktigt längtar till de! Har gjort varm oboy och kollat lite på 17 again. Den här låten gjorde mig på bra humör så de blir DAGENS LÅT : Tom Dice – Me And My Guitar :D <3
Nu ska jag ut och fota! Det var väl ändå jävlit längesen! Hörs!

JAG HATAR ATT JAG ÄLSKAR DIG

Den här dagen har varit den dåligaste på länge! Jag sa att jag skulle blogga idag. Men jag kanske sjukter upp det till imon oxå! Får se om jag bloggar mer. Det är lite mycket just nu.. hoppas nu förstår att inte bloggen kommer först!

MIN SKOLDATOR ÄR TILLBAKA!

SHIT VAD GLAD JAG ÄR!!! DEN ÄR TILLBAKA OCH ALLT ÄR KVAR!!! :DDDDDD <3<3<3<3<3<3<33<3<3<3<3

TIDEN LÄKER INTE ALLA SÅR..

Min fin hund, Brisse.. kom tillbaka! Allt skulle ha varit roligare och lättare med dig här! Jag minns det så väl den dagen du försvann. Vi skulle avliva dig den dagen, för att du inte mådde nå bra. När mamma var ute och gick med dig innan vi skulle åka så ramlade du ihop och dog. Mamma kom till skolan och hämtade mig och Tobias. Hon sa att du hade dött, och att vi skulle begrava dig på gården. När vi kom hem så låg du utanför huset på gräsmattan med kopplet på. Jag hade inte fattat vad som hade hänt, för jag var så liten. Bara 6 år. Du blev 13 år. Pappa var så ledsen. Han satt och grät och jag undrade varför. Jag hade fortfarande inte fattat. Även fast det var mer än en vecka sen då. Jag grinade inte då. Jag grinade långt efter när jag verkligen hade förstått att du var borta för alltid. Allt blev så tomt när inte du fanns där och kunde trösta mig när jag var ledsen. Du var så förstående! Världens bästa! Jag sitter än idag och gråter för att du inte finns, för att jag aldrig mer kommer få träffa dig. Saknaden är stor, för stor! Det är ett sår i mitt hjärta som aldrig kommer kunna läka. Men du kommer alltid finnas där, även fast du inte finns på jorden så finns du i våra hjärtan! Jag älskar dig gubben! ♥


ORKAR INTE BLOGG.

Har varit i Sandviken och Valbo, kom nyss hem skit trött. Ska kolla film nu! Hörs imon!

I'M WITH YA BRO!

HELL YEAH! ;D

I SHOULD'VE KISSED YOU

Har kollat på Wipeout! Skit kul äre :D Nu ska jag nog läsa och sen sova! :) Gonatt

THIS IS NOT GOODBYE, I'M ALWAYS ON YOUR SIDE

Kom hem från tandis utan nåra hål! Nu ska jag ta en Ristorante pizza och chillar till nått teväprogram eller en fin film! :D BYE

HAHA SÖTA!


FORGET AND MOVE ON

Hej!
Nu är jag hemma, lite halvtaskig dag.. idrott som första. Handboll, vilket jag verkligen hatar. Springer fram och tillbaka och jagar en boll det är vad jag kallar fjollboll!
Dagen fortsatte efter den tråkiga idrotten och sen kom det två killar från klassen som bar mig ner för trapporna och slängde mig i en snöhög! Älskar er PUSS!
Nu är det bara att vänta till halv 4 trorja det var, tandläkaren som gäller då! Chilla lite innan de sen när jag kommer hem så ska jag nog göra crepes! Fan va gott! Åt det i England med socker på fyfan va gott det var! Får se hur dom blir då! ;)

MÅSTE BARA VISA!

Älskar er!

HERE'S TO THE HARTBREAKERS WHO ARE SO GOOD AT KEEPING US AROUND

Hemma från zumba, har duschat och nu lyssarn jag på musik. Jag åt typ inge mat så jag är grymt hungrig nu! :( Måste äta nått innan jag ska sova! Men det här blir sista inlägget. Night guys! :)
Love to all of you.

LÄTTARE ATT SE NÄR JAG UPPDATERAR : BLOGLOVIN'

Jag sitter fortfarande kvar i soffan på mitt feta arsle när jag egentligen skulle städa mitt rum!
Imon ska jag till tandläkaren "OOOOH NOOOOOOO!" :'CCCCCCC '
Onsdag ska jag till sandviken och köpa dom där jävla mjukis byxorna! faan. Ja och juste jag ska kolla på tapeter sen efter de oxå! Vete inte om de blir i sandviken eller gävle! :)
Lite info om vad som händer i veckan! Alla andra dagar vet jag inte vad som hände.. jo typ på torsdag så äre dubbelliv! :D:D:D:D:D TAGGATAGGATAGGATAGGATAGGATAGGA! :D
precis just nu!

I LOVE YOU MAAAAAEEEEAAAAN!

Bara jag som alltid skrattar åt alla hans videor? x'D

HOME SWEET HOME

Hej! Har kommit hem, käkat min special macka ;) och kollar på tevä! Ikväll blire zumba som vanligt! :) Och nu snart så ska jag börja städa mitt rum! Behövs verkligen!
skit dålig hår dag idag, bilden är inte från idag btw!

FETT GLAD! :D

Jag blev en utav tre vinnare om dagens blogg hos http://thessi.blogg.se/

FAN VA JAG ÄLSKAR DIG HALSBRÄNNA!

dubbelliv - säsong 1 fanns inte kvart på svtplay :( måste ladda ner den!!

NU SKA JAG BÖRJAR KOLLA FÖRSTA SÄSONGEN AV DUBBELLIV!

(y)

VET INTE VAD JAG SKA SKRIVA OSV

Har varit hos mormor typ hela dagen. Aston, Lily och Kissen va oxå där, orkar inte säga allt vi har gjort. Men jag är sjukt trött nu! Duscha sen helst sova!

NU MÅSTE JAG SOVA!

Får ångest om jag inte går och lägger mig nu! Gonatt

JAG HAR "KOLLAT" PÅ FILMEN I 4 TIMMAR...

Nu har jag "kollat" ... hmm.. pausat filmen typ var 5-20 minut! Alltså har jag "kollat" på film i fyra timmar.. rekord! Jag kan inte kolla på film själv. Det är ALLTID såhär! Slår på filmen, kollar i typ 10-20 minuter, sen ba "de kanske har hänt nått på fb... eller nån kanske har bloggat" haha asså... jaja nu är den slut iaf! Och alla är ju så sjukt bra! :D

SÅ FIN!


PIRATES OF THE LUVA!

Nu blire pirates of the luva! :D popcorn och cola fan va gött! :D
:*

JAG ÄR MED OCH TÄVLAR!

Jag är med och tävlar för att bli dagens blogg hos http://thessi.blogg.se/

SVAR

Alica om VILKEN?:
den understa!
hur ändrar man sånt?;D
svar: Det är ju på google chrome!
Tryck på byt bakgrundsbild oså sen kan man bara söka, tryck på bilden du vill ha sen välj! :)

VILKEN?

den eller..
den? :D

HIHI

Har fått hem min bikini från HM och min väska! :D
:D väskan va ju hur snygg som helst! Så den får jag när jag fyller! :D

GOODMORNING

Hej!
Vaknade, kollade på klockan 09:08 ... "nee" kommer ut ur min käft. Och jag somnar om igen, till typ 10. Går ner käkar frukos och kollar på tevä.
Nu sitter jag uppe på mitt rum och funderar på vad jag ska göra idag! I have no idea. Jag duschade iaf igår kväll typ vid 10 - halv 11. Jag är en jävel på att duscha länge har jag märkt! ;)
Men iallafall det var hur skönt som helst att vakana upp med rent hår! Vilken känsla det är!
Ja och som jag sa så vet jag inte alls vad jag ska göra idag! Skulle va skit kul att åka madrass i backen! Men jag vet inte hur mycket snö det är där. Och om det är snö så lär jag leta på nån att åka med! :) Vi får se hur de blir med den saken. Jag är sjukt taggad för ikväll iallafall! :D Tacospaj, min tacospaj är så grymt god! Helt seriöst! Försök göra en bättre! ;)
Nu ska jag inte tråka ut er nå mer med min tråkiga information. Skriver mer sen! BYe
random bild.

YOU CAN ALWAYS MAKE ME SMILE

Nu ska jag kolla på Pirates of the luva eller hangover 2! :)

DUBBELLIV

Shit vad bra dubbelliv är asså! Då vet jag vad jag har att göra ikväll och imon ;)

DAGENS LÅT

DAGENS LÅT : Tom Dice – Me And My Guitar Sjukt bra! Gjorde nyss smoothie som jag pratade om i videbloggen! :) Sjukt goood :D

MEN OKEJ!

Läs inte min blogg om jag svär så himla (kanske bäst att sätta dit ett gudligt ord. himmel, jesus osv.) mycket så är det väl lika bra för dom som inte tål svärord att sluta läsa min helkassa blogg! Ingen bryr sig! Bara att dra! Bye, Adios, Hejdå! ;)

PLUGGLISTA

plugget hit och plugg dit :D lite blandat, från depp till flumm... eller de kanske inte blev depp låtar! Men det blev lite blandat iaf! Nuuuuu ska jag plugga

LÄNKBYTE!

http://almalinnea.devote.se/ En tjej som heter Linnea! Sjukt bra blogg, rolig skriver bra saker osv! :) Rekomenderar verkligen att ni ska följa henne! För hon är grym! :D
Sjukt fin oxå! :)

DÅ VET JAG.


HALV NIO OCH JAG TÄNKER SOVA / LÄSA!

Har ju en grym bok som jag läser! Ingen sommar utan dig. Så nu ska jag läsa den ett tag sen sova! :) Goodnight!

JAG KANSKE INTE GÖR MITT BÄSTA, MEN JAG FÖRSÖKER IALLAFALL

När folk är runt omkring dig är du på ett helt annat sätt. När det bara är du och jag stannar hela världen! Eftersom att du är hela min värld! Varför är du inte så jämt och ständigt, underbar.

FJORTON SUGER, SUGER VERKLIGEN! HEL KASS.

Just chillin' ;)

JUST DO IT!

so fukkin' true!

PUT YOUR HEARTS IN THE AIR

Vill se!
Hejhallå bloggen och alla bloggläsare! :) Tessan här! Sitter och lyssnar på Eric Saade och inte gör så speciellt mycket! (: Morsan och Agnes åkte nyss, morsan skulle till Valbo och Agnes till Gävle! Så nu sitter jag här helt alone. Ska kanske kolla på film eller nått :) Nej städa mitt rum ska jag göra! Vi hörs sötisar :)
Min önskelista!

VEM FAN ÄR INNE PÅ MIN SKYPE?!?!!?

damp jag får!!! går inte att logga in på skype för att "den används förmodligen redan av en annan skype-instans" FUCKOFF.

DAGENS BÄSTA + DAGENS LÅT!

DAGENS LÅT : Snoop Dogg & Wiz Khalifa – Young, Wild & Free - feat. Bruno Mars
Hej! :D Jag är så sjukt super glaad! :D Har varit hos Agnes sen typ halv 5 med hennes mamma och fixat mat och sånt! Agnes fyller nämligen år idag! Grattis vännen! :D ♥ Hon hade ingen aning om att jag skulle vara där så de blev liksom en "surprise" När hon kom hem så satt jag på en stol.. oså gick hon till soffan (förbi mig) och inte såg mig :D sen blev hon skit rädd när hon såg mig :D
Jaa oså DAGENS BÄSTA kommer vi till nu!!!! :D (jag har ju vetat dethär ett bra tag men har ju inte kunnat skriva det på bloggen för...) AGNES FICK ERIC SAADE BILJETTER TILL STHLM I APRIL!!! OCH JAG OCH EMELIE SKA MED!!!! :DDDD FAN VA KUL DET SKA BLI!!!!!!!! :DDD SÅ JÄVLA INIHELVETE TAGGAD! :DDDDD
Älskar dig bästa vän! :D Tagga Eric och sommar! :D

OST OCH SKINK PAJ!

Jävlar va gött säger jag bara :D Har en liten Fredde här som gärna vill smaka.. :o Ja men vi hörs imon gonatt :)

HEMMA, NY DUSCHAD OCH CHILLMODE! ;)

hahahahaha! Har man kul så har man ;)

BYTT OM! I'M READY!

see ya! ;D

JAG VILL HA DEN DU VAR FÖRUT.

Tjatja! Sitter och väntar på mat och läser lite gamla "chattkonversationer" på fb! Haha nolife ;)
FYFAAAAAAAAAAAAAN VA JAG ÄR SOMMAR TAGGAD!!!! :DDD WIOHHOOOOOOO!! FAN VA KUL ALLT SKA BLI!! CYKLA TILL AGNES HEM TILL MIG, VA MED ANTON OCH JOEL! HA VATTENKRIG MED JOEL OCH OSKAR! FAN VA KUL ALLT SKA BLI!!! :D puss på mitt sommartaggande! :D <333

THERE'S ONLY ONE THING TO DO, THREE WORDS FOR YOU I LOVE YOU.

Kom hem för ett tag sen, tog en kladdkaka och kollade på tevä, nu läser jag typ bara bloggar. Blev inte sandviken för morsan sluta senare -.- och ikväll blire zumba är inte så jätte taggad.. men det blir säkert kul! :)

NEJ MEN LILLA..

Stackars Eric! Varför var jag inte hos honom.. fatta vad lessen han är just nu.. barra för att jag inte var där! Jag är ledsen! Förlåt älskling! :*

DAGENS LÅT

DAGENS LÅT : Train – Drive By

SO DAMN HOT! ♥

Äre bara jag som älskar den här killen?! SOM FÖLJER MIG PÅ TWITTER!! :''D <3
Gjorde nyss en kladdkaka, faaan va god den blev! Inte för att skryta men så jävla goooooood! :D

SOMEONE LIKE YOU..

Jag låg på soffan och sov, oså kommer Henric och lägger typ ett blött, skit kaltt papper på min hals! Fyfan vad jag ryckte till! Käkade nyss. Och nu vill jag bara sova igen! funderar på att duscha men jag vet inte om jag orkar.. jag duschade ju igår. Om håret är skitit imon så får det vara det! En dag i skolan med skitit hår gör inget! Jamen vi hörs!

YOU CAN HATE BUT NEVER BREAK ME

Har målat klart och just när är jag med Lily.. är helt slut i armarna efter att ha målat i taket! Vill bara spela sims nuuu! Ska kanske försöka med Sims 3. Det är jätte tråkigt, men de var ju länge sen jag spelade de! :) Höres!

ÄR MED SÖTISEN!


UTE OCH "JOBBAR"

Hej!
Är ute i garaget och målar! Så jag bloggar när jag är klar med det! :)

GOODNIGHT FOLKS

Gonatt darlin's

<3

EN HEL DAG I VALBO!

Har haft en kul dag i valbo! Kom nyss hem! Vi grillade korv på baksidan av deras gård ist för att grilla i skogen! Jag hade långkalsonger, träningsbyxor och täckbyxor men frös om benen ändå :o Sen sov ungarna i 2 timmar så då passade vi på att fika och kolla på bilder på Side i Turkland (dit vi ska) Fyfan va jag är taggad! :D Det var en skit bra låt på radion när vi var på in dit. Och den blev helt klart DAGENS LÅT : Robert Pettersson – My Own Worst Enemy :D Imon så ska jag nog bara plugga lite engelska och sen se vad som händer! :) Hör av er om nån vill göra nått! (:

I AM SOMEONE ELSE WHEN I'M WITH YOU, SOMEONE MORE LIKE MYSELF.

Gomorron!
Nu ska jag göra mig iordning, ska he till Kissen och grilla korv i skogen och åka fyrhjuling osv. Så jag kommer nog inte uppdatera nå mer innan jag kommer hem ikväll! Hörs hej! :)
gammal bild.

FREJJ

HEJSAN. ojj caps. <Ehh jag ska va tråkug ovh sova nu, är s¨å jävla vtrött. ginatt.

NU, PS I LOVE

<3

SÖT!

hahaha x'D
Åt nyss mat och nu ba kollar jag in massa roliga saker :D yääääääääääääää.

OH MY GOD! HAHA!

x'''''D

JAG ÄR MED OCH TÄVLAR!

Jag är med och tävlar för att bli dagens blogg, här : http://almalindqvist.devote.se/

WHY DO FOOLS FALL IN LOVE?

Hejhej! :)
Gick nyss från bussen. Anna var här så följde med henne till bussen, oså när går Anne (grannen) ut från bussen oså åh... "hej :)" "heej :)" "var det fästmannen?" "haha neej.. :$" "vem var det då?" "Anna... haha" "jaha hah.." Sjukt pinsamt! x'D Men nu är jag inne i värmen! Shit vad kallt det är ute alltså! Åhh.
Ska väl göra tacos sen. Gött! :) Skulle vara sjukt kul att ha film kväll med folk! Typ Anton, Victor och Agnes! Sjukt kul! :D menmen, ska väl inte göra så mycket i helgen.. Bara chilla oså.
Ikväll tänkte jag kolla på lite film! Jag kommer ha sjukt mycket ångest ikväll, jag följde ju inte med pappa till ica, och vi har inge godis eller läsk (trorjag) och säkert inge popcorn! Mamma slut halv 6 eller nåt så får väl åka dit då eller om pappa skjutsar mig nu! :) Ska nog kolla upp det. Hör av mig mer sen! Hejsvejs :)
You're so beautiful, but that's not why I love you. I'm not sure you know that the reason that I love you, is you being you, just you.

Gonatt vafan..

Spelat wordfeud... blir bara surare och surare. Fan alla äger ju mig! Alla ord jag kommer på får jag ju inte skriva :( fick inte skriva : "knäpp, porr...." kommer inte ihåg de andra... men jag fick skriva balle... vafaaan. fast det var dagens roligaste typ... nejemen.. Gonatt!

HUR BRA SOM HELST

<3

WORDFEUD

Jag är Wordfeud nörd! Om nån har lust att spela så heter jag : tessanvaannars :)
Åt nyss en ananas.. och jag verkar vara allergisk.. :( svider och klias på tungan och runt munnen.. när jag äter en Hawaii (pizzan som det är ananas på så händer inget! men åhhh det som är så gott! :(
Jaja nog om det! Ringde mormor när jag kom hem, så åkte vi till ica och köpte frukt + youghurt! Oså gjorde jag smoothie! Skit god ;) Vet inte vad jag ska göra eftersom att någon är sjukt osocial och bara dissar! Uppdaterar kanske lite mer sen, har ju inte precis nått att skriva eller göra så... :)
Ajj min tunga :(

YOU'RE SO DAMN HOT!

If you want him, fight for him!

HAHAHAHA

http://www.tv4.se/idol/klipp?videoid=1987459&treeId=3020207
Seriöst!!!! jag dööör x''D

SER DU STJÄRNAN I DET BLÅ, JA DEN LYSER FÖR OSS TVÅ.

*döööör* :'D
duschade nyss och nu dör jag lite :D

SO WHAT.

Hej!
Har nyss kommit hem från Agnes! Gick hem från skolan, slog på datorn, Agnes ringde på skype, och jag åkte dit! Nu snart så måste jag duscha! Men innan så tänker jag göra en lista! bara för att jag har tråkigt... :(
Höger- eller vänsterhänt: Höger
Humör just nu: Både glad & irriterad och trött
Favoritgodis: Oj svårt, allt faktiskt :}
Är det nåt du absolut inte äter: Pölsa
Kläder just nu: Träningstightsen & en huvtröja, haha
Musik just nu: Ingen, kikar ju på tevä
Vad sa du senast: "Hej då!" till mammie som åkte
Om du var tvungen att leva i en annan tidsepok, vilken skulle du välja då: 40-50 talet såklart
Sommarplaner: Jobba, komma igång på riktigt med Pinup-projektet, sola&bada, festa och leva livet
Fisk eller badkruka: Haha, jag är en riktig badkruka, men var en riktig fisk som liten, då var jag i vattnet jämt
Saft eller alkohol: Saft till vardags, alkohol till fest :>
Hur många kuddar sover du med: Hemma i färnbo, 2 stycken, hemma i lägenheten, en kudde
Favoritväder: Soligt såklart, men regn kan va mysigt ibland det också
Om du var fast på en öde ö, 3 saker att ta med: Telefon, båt & mat
Spelar du nåt instrument: Nej, men skulle vilja kunna spela typ gitarr eller banjo
Morgon- eller nattmänniska: En riktig nattuggla! Hatar mornarna, usch, tviiiiii
Sparare eller slösare: Usch, slösare lär jag tyvärr säga
Bästa film: Oj mååånga! Nyckeln till frihet och Walk The Line är två favoriter
Tror på liv på andra planeter: Det finns det absolut tror jag
Kommer du ihåg din första kärlek: Haha jaaa
Älskar du henne/honom fortfarande: Nejnej
Har du några homosexuella vänner: Det har jag faktiskt
Tror du på mirakel: Hmm.. Inte förns det sker
Tror du på att det är möjligt att vara trogen för alltid: Det är väl klart!
Ser du dig själv som tolerant mot andra: Jaa men det tycker jag verkligen
Ser du på kärleken som ett misstag: Nej, aldrig, det är verkligen nått fint
Hur många barn vill du ha när du blir stor: Högst två stycken
Bio eller promenad: Bio
Är du kittlig: Hahaha ingen kommentar...
Snarkar du? Nej, duktig så faktiskt ;}
Stjärntecken? Kräftan
Rädd för insekter? Nej varför skulle jag? Inget farligt, fast jaa bin & getingar och sånt
Äckligaste insekten: Mygg, bin, getingar och den här som luktar fis? Va heter den? Jo, Bärfis, haha
Det här är jag bra på: Vara mig själv rakt igenom, ställa upp för andra, älska min familj & pojkvän
Bästa bok? Jag läser aldrig böcker, men isåfall måste jag säga Johnny Cash självbigrafin som jag läste förut när jag gick i högstadiet, underbar bok men tjock
Om du fick välja en superkraft, vad skulle du välja? Typ trycka på en knapp så var man där man önskade sig att man var, typ förstå ute i kylan, man fryser som fan och man bara vill hem, ENKELT trycka på knappen och *vips* så var man hemma, eller så typ flyga, eller läsa andras tankar eller osynlig.
Vad vill du jobba som? Pinup-fotograf såklart
Chips, morötter eller godis? Godis absolut, men jäklar va chips också är gott
Pizza eller hamburgare? Mums på båda lär jag säga, Walles pizza och Lasses hamburgare, mums!
Skriver du dagbok? Gjorde förut när jag var yngre, men inte nu längre, men man kan ju säga att bloggen är som en enkel dagbok
Tänker du någonsin tatuera eller pierca dig? Var nånstans? Gjort redan, och än är jag inte klar, med tatueringar alltså, inga fler piercingar blir det, kanske i naveln, räcker med en uttöjning i örat
Stökigt eller välstädat? (ditt rum, hus, lägenhet m.m.) Välstädat, är ganska noggrann på det viset av mig, tycker inte om att vara i ostädad miljö
Gungar du på stolen? Ibland, ibland inte, beror ju på om det är en gung-tillåtlig stol
Skulle du någonsin få för dig att hoppa bungy-jump? ALDRIG!
Vilken hand håller du gaffeln i? Höger
Är du rädd för blod? Nej, men i stora mängder skulle jag nog blir lite rädd
Saltar du på maten? Inte ofta
Gillar du att sjunga? Absolut, men bara när ingen hör ;)
Anser du att du är stark? Haha, för att vara så här liten är jag väl kanske lite stark iallafall
Brukar du sola? Jag skulle vilja ha tålamod för att sola mer, för det är så fint & vara brun
Vad gör du om du får hicka? Dricker vatten från andra sidan glaset, hihi
Röker du? Nej fan!
Snusar du? Nej!
Använder du knark? Aldrig!
Kaffe, te eller inget? INGET, usch.
Har du en besatthet? Av godis, ja!
Höger- eller vänsterhänt: Höger
Humör just nu: sådär. trött.
Favoritgodis: typ allt
Är det nåt du absolut inte äter: lax, lamm, kräftor!
Kläder just nu: Jeans, linne, tröja osv.
Musik just nu: ingen just nu
Vad sa du senast: "Hej gubben :* "
Om du var tvungen att leva i en annan tidsepok, vilken skulle du välja då: Vet inte..
Sommarplaner: Kanske sommarjobba, sola,bada, träna, kompisar, turkland tyyp.
Fisk eller badkruka: Jag är nog fisk trorja :)
Saft eller alkohol: Saft.
Hur många kuddar sover du med: tvååå
Favoritväder: Soligt och varmt!
Om du var fast på en öde ö, 3 saker att ta med: Telefon, mat, spade
Spelar du nåt instrument: Inte just nu, men har ju spelar piano så de kan jag ju!
Morgon- eller nattmänniska: Beror på vilken tid på morronen och vilken tid på natten!
Sparare eller slösare: både och!
Bästa film: The Holiday!
Tror på liv på andra planeter: Neej.
Kommer du ihåg din första kärlek: jaa..
Älskar du henne/honom fortfarande: neej. Kanske bara som kompis!
Har du några homosexuella vänner: jag tror inte de..!
Tror du på mirakel: neej..
Tror du på att det är möjligt att vara trogen för alltid: Njea kanske..
Ser du dig själv som tolerant mot andra: maybe (stavning)
Ser du på kärleken som ett misstag: nej?!
Hur många barn vill du ha när du blir stor: KANSKE 2
Bio eller promenad: beror på med vem! och vad för film! ;)
Är du kittlig: troru?! :o
Snarkar du?: Vet inte
Stjärntecken? Tvilling
Rädd för insekter? jaaa!! :'c
Äckligaste insekten: Mygg, bin och spindlar, fast spindlar är ju typ ett djur!!!!
Det här är jag bra på: vara mig själv! deppa ;) finns väl mkt mer men orkar inte.
Bästa bok? åhhh! ingen sommar utan dig kanske? fast har ju inte läst klart den..
Om du fick välja en superkraft, vad skulle du välja? men bara en?! D: jag väljer flera! bli osynlig, läsa folks tankar (fast bara när jag vill) flyga tyyp :D
Vad vill du jobba som? Inredare!
Chips, morötter eller godis? godis vafaan :o
Pizza eller hamburgare? pizza helt klart!
Skriver du dagbok? Gjorde när jag var liten.
Tänker du någonsin tatuera eller pierca dig? Var nånstans? Ska ta hål i naveln, oså tatueringar ska jag väl ha lite här och där! :)
Stökigt eller välstädat? (ditt rum, hus, lägenhet m.m.) Stökigt i mitt rum!
Gungar du på stolen? ja ibland kan man ju bara inte låta bli :D
Skulle du någonsin få för dig att hoppa bungy-jump? ALDRIG!
Vilken hand håller du gaffeln i? höhöhöhö..ger
Är du rädd för blod? rädd? tycker det är sjukt äckligt oså är jag väl mer rädd för att svimma om jag ser blod :s
Saltar du på maten? aldrig.
Gillar du att sjunga? japp, men då är det bäst om ingen lyssnar!
Anser du att du är stark? vaddå muskler eller såhär... stark, nej man jag är inte stark (muskler)
Brukar du sola? Ja när det är sommar så!
Vad gör du om du får hicka? Ställer mig uppochner med huvet och dricker vatten med ett sugrör, elr ingenting!
Röker du? Nej!
Snusar du? Nej!
Använder du knark? nej!
Kaffe, te eller inget? te!
Har du en besatthet? Av godis, ja!

SMARTA TANKAR FÖR ATT BÖRJA TRÄNA! (TILL MIG SJÄLV)

Det här är INGET som jag vill att ni ska ta åt er. För alla ser olika ut! Men det här är lite ord till mig, och även till andra som vill få nått att tänka på.. även om ni inte ska ta åt er så hemskt mkt. Eftersom att jag är elak mot mig själv när det gäller att träna... och att kliva upp på morgonen!
  • Den du gillar kanske inte vill ha en fläskkotlett med bara fett till flickvän.
  • Dom på stranden kollar mer på dig om du har en finare kropp!
  • På idrotten behöver man kondition, bäst att börja jogga innan pensionärerna går förbi!
  • När det är sommar vill man kunna ha shorts, klänning, tunika, kjol osv. utan att behöva skämmas för sina feta ben.. tänk om nån snygg kille är i närheten! ;)
  • Träna inte för hårt, eller ha FÖR höga krav på dig själv!
  • Träna helst ensam, om du t.ex ska jogga i ett elljusspår. Det blir lätt att man bara koncentrerar sig på att prata med kompisen och tappar tempot! Ha ist musik i örorna! :)
  • Du ska självklart äta nyttigt ist för att äta den där jätte goda...hamburgaren på donken, och dom där lagom saltade (fettiga). Ni fattar ;)

Faktiskt riktigt bra (för mig) att tänka på! :) Jag har redan sagt gonatt en gång men jag gör de igen! Gonatt :)

I MISS YOU.

Börjar inlägget med den sjukt bra "cover låten"! jaja, slängde ihop en kladdkaka lite snabbt för ett tag sen (y) oså fikade vi de och kollade på ehhehhehehehe... va heter de?! mäster kocken elr nått sånt! :) nu börjar Tessan bli trött! Nu ska hon snart sova :) Gonatt! :*

"HEJ ALLA SMURFAR DET ÄR SOLSKEN IDAG"

11 saker som tjejer älskar:
♥ pojkar som börjar skriva i chatten.
♥ killar som skriver långa sms om hur mycket de tkr om dig.
♥ pojkar som kramar dig bakifrån.
♥ pojkar som tittar på dig som om du skulle vara den enda tjejen han ser.
♥ pojkar som kysser dig om du skriker på dem.
♥ pojkar som inte bara skriver ok, utan snarare ger ett något längre svar tillbaka.
♥ pojkar vågar att visa känslor för dig framför andra.
♥ pojkar som ger/lånar ut sin hoodie.
♥ pojkar som kysser dig bara för att få dig att hålla käften.
♥ pojkar som alltid tar din hand.
♥ pojkar som älskar dig för vem du är!


BORING STUFF

Lovar du att vara ärlig? ja
Du heter: Therese
Smeknamn: Tessan, Tess, Tessie typ
Låt som när du är ledsen sörjer till: God damn you're beautiful - Chester See
Beroende av: vet inte..
Vad tror folk om dig: vet inte
Stämmer det: vilket då? :)
Vad får du oftast komplimanger för: lite olika från person till person. :)
Vad säger du för att imponera på någon: haha vet inte xD
Hur imponerar man på dig: Jadu, kan inte komma på nått bra nu men... men som Ulrik, spela munspel och spela gitarr samtidigt :o
Brukar du skratta för dig själv: haha jaa :)
Vad står det i ditt senast inkomna SMS: haha, okej ;)
Var bor du: Färnbo fortfarande ;)
Trivs du där: jadå
Äger du några converse: japp!
Brukar du bli för full: näe
Är du allergisk mot något: tror inte de
Hur svarar du i mobilen: Hallå, aa, vad?
Antal timmar sömn inatt: 9 trorja..
Brukar du komma i tid: ...feltolk... nejmen jaa, till skolan menar du va?
När mår du bra: när allt är helt perfekt! när jag är glad :D
Hur känner du dig nu: trött som fan, men ändå glad :)
Vanligaste färg på dina kläder: svart, grå blå-(jeans)
Vad tycker du om fötter: äckliga!
Vad saknar du: Spanien! Någon..
Hade du en bra kväll igår: Igår..? Nej! mådde illa som en full matad.... koröv!
Favorit dryck på morgonen: Juice, oboy, te, vatten
När brukar du oftast gå och lägga dig: på vardagar så äre väl typ 10-11 och helgerna lite närsom! :)
Är du blyg: ja faktiskt! Ibland så.. :$
Sysslar du med någon idrott: ska ju börja på zumba om de räknas?
Tror du på kärlek vid första ögonkastet: "eller ska jag gå förbi en gång till ;)" nejmen, ja det gör jag nog.. ;)
Är du nöjd med ditt liv: Det är bara HAN som saknas så är allt bra! :D
Är du bortskämd: Nej de tycker jag inte!
Vad gör du i morgon: skolan, sen chilla, yeeeee
Vad längtar du till: SOMMARLOV!! :D
Har du bra vänner och äkta vänskap: Japp :)
Hur gammal är du: tttttrreeeeton
Tycker du om någon just nu: ja det gör jag!
Gröna eller röda äpplen: röda!
Gillar du golf: nej..
Vilken tid gick du upp idag: 7
Är det okej att gråta: självklart!
När grät du senast: IGÅR!! NÄR MIN DATOR DOG OCH JAG INSÅG ATT ALLA BILDER PÅ DATORN KANSKE FÖRSVINNER!!
Solar du ofta: när det är sommar så!
Hur ofta tränar/motionerar du: brukar ju köra nåra armhävningar och situps då och då :)
Senaste låt du hörde: The end of time - On the roof (y)

FUCK HICKA!

Hur drygt är det inte att ha hicka?! man sitter och ser störd ut och ba "huuö HUUUÖ UHÖ! ..... serri asså ;o
GET OUT GET OUT GET OUT OF MY HEAD!
I'M BROKEN, DO YOU HEAR MEEE?!
SERIÖST!! sluta skicka "minkalender" på facebook sjukt störande! vem pallar "få förfrågningar" hela jävla tiden?! :D
arkiv! :D

SOME KIND OF HOME

Det är skolvecka! Man blir lätt tjurig, speciellt när man är trött! Oså är små kusinerna här.. Då blir man ju lite små irriterad och trött!
Jamen förutom det så har vi bokat biljetter till Turkiet! Ett jätte fint hotell, femstjärnigt trorja. Med spa osv. Massa pooler! Fatta vad jag kommer njuta! :D Oså äre internet på rummet! Skit bra! Så då tar jag ju med datorn så jag har nått att göra på kvällarna oså :) Men det här är ju på sommarlovet! Vet inte riktigt vilket datum.. men i juni nångång! :)
Skolan gick väl rätt så bra idag. Man var väl kanske lite trött! Även fast jag somnade på engång igår! :o jaja, shit the same. Vi hörs senare! (:
random bild.

LITE INFO OM BLOGGEN.

Kommer inte kunna blogga innan jag har slutat skolan.. är hemma halv tre typ. Eftersom att jag inte har nån skol dator och inte kan blogga från mobilen så, men jag måste dra nu hejdå :)

NU SKA DEN HÄR TJEJEN DRA TÄCKET ÖVER HUVET OCH SOVA!

Gonatt! Vi hörs imon om jag överlever natten. :*

VARFÖR FÖRSÖKER JAG ENS NÄR DU INTE ENS BRYR DIG?

Skakar, helt blöt på kinderna, fult grin ansikte har jag oxå, mitt hjärta blev helt plötsligt halvt. för alla bilder är borta i den andra halvan, man ska absolut inte blogga när man är depp. FML.

ALLA BILDER, FILMER OCH MINNEN!

FAN. NU HATAR JAG MIG! VARFÖR SKULLE JAG STÄLLE LAMPAN PÅ BYRÅN! JAG SITTER FAN OCH GRINAR!! ALLA ERIC OCH ULRIK BILDER!! VAFAAAAAAAAN HELVETEEEEE :'( JAG VET INTE OM JAG HAR LAGT IN DOM PÅ ETT USB HELLER :(

HÖLL PRECIS PÅ ATT BLOGGA NÄR..

Jag höll på att blogga och sen ramlade en sängbords lampa ner från byrån *PANG* ner på datorn! Shit vilken jävla chock jag fick! Så nu är den hel slut oxå typ... Går inte att starta. Shiiit :o Nu har jag min riktiga dator!
Jag höll på att skriva DAGENS LÅTAR. Så jag gör de igen då!
DAGENS LÅTAR : Dyland & Lenny – Pégate MásComando Tiburon y Mach & Daddy – Pasado PisadoDe Vet Du – Kär I En Gamer och Juan Magan – No Sigue Modas! :D Sjukt bra allihopa :D

...

Agnes och min paj blev grymt god! Och har nyss kommit hem från mormor och ätit moussaka.. Jag mår illa som.. jag vet inte vad! Mår inte ens så här illa när jag har magsjuka! Fyfan! Skulle inte precis bli förvånad om jag fick magsjuka nu! åhhh eeööööö

LEV VARJE DAG SOM OM DET VAR DEN SISTA

Värt att läsa

Livet är för kort för att vakna upp på morgonen med ånger. Så älska dom människor som behandlar dig rätt och glöm dom som inte gör det. Tro på att allt händer av en anledning. Om du får en chans, ta den. Ingen sa att det skulle vara lätt, de lovade bara att det skulle vara värt det. Det kommer komma en dag i ditt liv när du inser vem som verkligen är viktig,  vem som inte är och vem som aldrig har varit. Så glöm folk från ditt förflutna, för det finns en anledning till varför dom inte klarade sig till din framtid. När vi växer upp får vi veta att även den personen som inte var meningen att någonsin göra dig besviken förmodligen kommer att göra det.
Du kommer att få ditt hjärta sårat mer än en gång och det är svårare varje gång. Du kommer såra hjärtan också, kom då ihåg hur det kändes när du var sårad. Du kommer att bråka med din bästa vän. Du kommer att gråta för att tiden går för fort, och så småningom kommer du förlora den du älskar.

Så ta för många bilder, skratta för mycket och älska som om du aldrig varit sårad, eftersom alla 60 sekunder du spenderar är 1 minut av lycka som du aldrig kommer få tillbaka. Skratta när du kan, spela hårt, förlåt snabbt, ta chanser, ge allt och ha ingen ånger. Livet är för kort för att vara allt annat än nöjd. Gör det bästa av ditt liv, lev det med lycka och låt inte gårdagen ta för stor del av dagen. Med andra ord, må bra! Ta vara på dina närmsta, ta inte för givet att alla finns för dig, du bör finnas för dom med.
http://aamandabecklin.blogg.se/

L.O.V.E. 1D!

VI agnes och jag asså ;) bakar just nu! :D yeah you know it honey! biieeetch fuck you maaan!
yeah fuck off! ;D

HEJ ALLA BLOGG LÄSARE! :)

Heej! Är med Agnes just nu! Vi var nyss till ica och handlade lite grejjs! :) Det blev en Ristorante pizza, bacon, blåbär och hallon och margarin. Vi tänkte att vi skulle baka lite sen efter att vi har ätit! (: Tror det blir blåbärochhallon paj med marängtäcke! :)
Men vi hörs väl senare! :)

NU SKA DEN HÄR TJEJEN SOVA!

Gonatt allihopa! Det var faktiskt riktigt många som var inne på min blogg idag! Hoppas att de fortsätter så! :) Kom ihåg att kommentera och vi kan gärna ha ett länk byte av blogg om det är så! :) Och glöm inte att följa mig via bloglovin. Vi hörs imon alla bloggläsare! :)
Love you

TROR DU PÅ KÄRLEK VID FÖRSTA ÖGONKASTET? ELLER SKA JAG GÅ FÖRBI EN GÅNG TILL? ;)

Kollar film jao. A cinderella story! sjukt bra ;) jaooå.
du är en dryg playig sak.
som tror du kan få alla.
så jävla patetiskt.
varför bryr du dig inte om dom som gillar dig?
what the fuck is wrong with you?
I have no fuckin' idea!
now i'm just gona shut the fuck up.
and return to my movie!
Goodbye fuckers! :)

MIN BLOGG SUGER OSV.

hahahahahahah sjukt kul!

DU FÖRSTÅR INTE HUR MYCKET JAG FÖRSÖKER..


JAG HATAR ATT HA TJOCKT HÅR!

Man kan inte göra nått med det! Det är helt omöjligt att fläta två flätor  på varsin sida av huvet! den ena blir skit tjock och den andra skit smal! FMH...FUCK MY HAIR.. för dom som inte fattade!
åh.

ÖVNING GER FÄRDIGHET!

Försökte nyss göra en inbakad fläta på MIG SJÄLV! provade 5 ggr oså nu gick de!! men de blev lite trassligt oså men jag kan jag fattar hur man gör! Fan va glad jag blir! :D

DET ÄR STÖRANDE SÅ TRYCK F5

tryck f5 så ser ni min nya "rubrik stil" de är störande att de den gammla xD
jag vet inte... men jag hade bruna armar iaf! :D

ÖNSKELISTA + DANS

Jag fyller ju år i juni... men det här är nog första året som jag vet precis vad jag önskar mig! :D
  • Iphone 4 (svart)
  • Tevä
  • Pressentkort på köpis i valbo asså.
  • "resa" alltså en upplevelse. Som typ grönan som jag har åkt till nästan alla år! :)
Det är inte så många saker.. men då är dom ju lite dyra ist! Nu vet ni de oxå! :) Och här kommer ett litet filmklipp från när Agnes och jag dansade som små! :)
piiiinsamt :)

LOVE MY LIFE!

Jag vet inte! Men jag blev nå sjukt glad nu! vet inte varför men bara blev de! :D <3
BLEV SJUKT GLAD NÄR JAG FICK DEN! JAG ÄR TYP LIKA GLAD NU SOM DÅ! :D
SJUKT SKÖN LÅT : Jay Smith – Black Jesus

TACK BRORSHAN!

Min sjukt gulliga brorsha stämmer min gitarr just nu! Sjukt snällt! :') TACK BRORSHAAN! :D

SERIÖST! TOBIAS SMÄLLDE IGEN MIN DÖRR SÅ ALLT PÅ HYLLAN RAMLA NER!

Ja hej! Nu är jag hemma! Det blev lite för sent igår kan ma ju säga! Men vi hade kul iaf! :) Kollade på film osv. :)
Imon så kommer Agnes hit.. Typ vid 10..? Och jag ska försöka lägga mig 11 idag! och gå upp 8 imon.. Skolan börjar på tisdag och det är nått jag inte längtar efter precis! Kommer bli jätte svårt att komma upp då! :( jaja, nog om de! Kan inte den här jävla snön smälta snart så man kan börja rida! Vågar inte rika när de är så halt ute.. :(
Kom bara på att den här låten är bra.. helt random ba!

LISTA

- OM DIG/ ALLMÄNT -
Hur gammal är du? - 13
Hur lång är du? - vet inte
Har du några piercingar/tatueringar? ja öronen
Vilken skola går du på? - österfärnebo
Vad vill du bli när du blir äldre? - Inredare!
Är du singel? - yes
Har du syskon? - yesyes
Vart bor du? - färnbo
Är du nöjd med dig själv? - jadå
Vad tror du andra får för intryck av dig? - Vet inte..
Vilken maträtt kan du verkligen inte äta? - Lax!
Din naturliga hårfärg? - Blond

- SENASTE -
Som ringde dig? - vetinte
Som smsa dig? - Agnes
Som du smsa? - Agnes
Som du kramade? - Mr. Mjauoan
Som du kysste? -
Som du slog? - Vet inte
Som slog dig? - Vet inte
Som du dela dricka med? - Tobias

- KÄRLEK -
Har du pojkvän? - Nej
Hur många gånger har du varit kär? - nåra gånger.. ;)
Har du blivit dumpad? - ja
Har du dumpat någon? - ja
Är du romantisk? - när de behövs så!
Kärlek vs sex? - kärlek
Vad faller du för hos killar? - Ögon och hår!
Tror du att man kan hålla ihop föralltid? - Njea.. fast inte om man blir tsm för ung! :)
Vad är det finaste en kille kan säga till sin flickvän? - Sanningen.

- ANVÄNDER DU... -
Deodorant? - Ja
Parfym? - Ja
Kjolar? - Nej
Klänningar? - Nej, tunika
Hoodtröjor? - Jarå
Hårmousse? - Nej
Hårspray? - nej
Klackskor? - Nej
Body spray? - body lotion
Rouge? - ibland!
Foundation? - Nej!
Ringar? - Ja
Mössa? - Jarå sometimes
Hårband? - Nej
Nagellack? - Japp

- SANNINGEN OM DIG/ DÅLIGHETER -
Har du druckit så mycket att du spytt? - Nej
Har du slagit/kastat något mot en glasruta så att den krossats? - Jag vet inte kanske..
Har du druckit en alkoholdryck utan att veta vad det är för något? - nej
Har du strulat med en främling? - Njea..
Ljuger du ofta för dina vänner? - Näe
Har du tagit en väns pojkvän? - Nej
Har du hotat någon? - Ja .. men asså inget dumt liksom.
Har du mobbat någon? - Nejj

- VEM/VILKA... -
Är din bästavän? - Agnes
Saknar du? - Nåra kompisar och jaa..
Vill du träffa just nu? - DIG.
Stör du dig på? - nåra!
Skrev åt dig senast på facebookchatten? - Oscar -.-
Vem puffade dig senaste på facebook? - Emma!
Vem skrev du senaste med på msn? - Agnes
Vem kommer du träffa imorgon? - Cotten och dom hemma..
Vem har du inte träffat på länge? - Klassen.
Vem skulle du ta med dig på en utlandsresa just nu? - Agnes! :D
Festar mest av dina vänner? - Hahaa...
Är snyggast i klassen? - :)
Hamnade du senast i grupp med i klassen? - Inte vet jag :o ska jag komma ihåg de?! :o
Skulle du vilja se ut som? - Ashlee Simpson :D

- JA/ NEJ FRÅGOR -
Är du helsvensk? - ja
Är du glad just nu? - ja
Har du en hund? - nej
Har du en katt? - ja
Har du varit utomlands nångång? - Ja
Är du blyg? - ja lite..
Ska du ta körkort? - Ja
Ska du tatuera dig/pierca dig? - ja
Har du en egen dator? - Ja
Är dina föräldrar skilda? - Nej
Mår du bra just nu? - ja

ashlee

DET LÖSER SIG SA GUBBEN SOM SKET HÅRT!

Tjatja! Är hos Cotten nuuu! :) Jag har inget mer att säga än så. Vi ska kolla på film sen och flumma :D BYE! :D
SJUKT SNYGGAAA! EFTER MIN PRUTT SOM JAG SLÄPPTE PÅ GINATRICOT SÅ BLEV COTTENS SMILE LITE ANSTRÄNGT...! :$

YOU ARE MY BIGGEST LOVE..

NATTENS LÅT : Death Cab for Cutie – I Will Follow You into the Dark
Gonatt!

IMON SKA JAG ÄNTLIGEN FÅ HA KUL!

Fail om det hade blivit ett k på slutet på rubriken...! NEJ INGE SNUSK PÅ BLOGGEN HÄR INTE! Ja imon iaf, så ska jag till Cotten vet inte vilken tid med på eftermiddagen nångång. Skrattkväll! Det var längesen! :D Så vi ska väl kolla på massa film och ha allmänt kul! :D Men nu ska jag väl sova.. vilket inte kommer gå! Eller jag kan ju lägga mig 1 kanske :D jag har sjukt svårt att gå och lägga mig.. xD men vi hörs imon iaf... nångång gonatt! :)
lite dåligt med nya bilder så de blir ingen bild nu!

ÅH VA JAG HATAR NÄR MAN ÄR PÅ JÄTTE BRA HUMÖR OSÅ..

Jag hatar när man är på jätte bra humör, vilket som var ett tag sen för mig! oså sitter man och skrattar jätte mycket och har skit kul! oså kommer en dryg jävel som är tjurig och säger nått helt onödigt så man blir tjurig! fyfan för dom. Sitter och klagar på sitt jävla liv. Dom vill ha en flickvän/pojkvän men dom försöker ju inte ens! Och om dom försöker så lär domväl försöka mer vafan, de är väl som att en kille försöker skaffa barn med en annan kille genom att ha anal sex.. försöker man inte ens så blire inte men killar som vill ha barn med en annan kille kan ju fortsätta k.... varann i röven. Men nu blev jag glad igen! :D
:D

LISTA, NI ÄR FÖRVARNAD! ;)

Vilken färg har dina skor? - typ vit och svart, men sen äre ju rött på do vita oxå, blå oxå kanske?
Hur många sms har du skickat med din telefon? - vääääääääääldigt många!
Vem är nummer 9 i din kontaktlista? - Axel :)
Vilka finns i din "mottagna samtal"lista? - rensade den nyss.
Vilka namn finns i din smsinkorg? - Agnes, Joel, Cotten, Hanna tyyp.
Vem kysste du senast? - dedu :)
Vem kramade du senast? - jadu... om jag kommer ihåg de :p
När såg du din bästavän senast? - Nyår? seriöst?! nyår?! :o
Din favoritfilm? - The Holiday! :D
Din favoritlåt? - oh de är många, så kanintevälja ;)
Bär du på en stor hemlighet just nu? - nej.. eller kanske? vet inte ;)
När vaknade du imorse? - 11
Gillar du hästar? - jaaa :) ♥

Har du ett turnummer? Vilket? - 7 och 8
Vem hade du velat träffa just nu? - Zayn Malik!! :D ♥ eller Eric!! :D 
Vilket är det bästa året hittils? - Hoppas dethär blir det bästa!
Är du kär? - kanske.. jag vet inte riktigt..
Är du en rökare? - nej.
Föredrar du snus eller rökning? - nada
Vad heter du i mellannamn? - förfultförattvisashär!
Har du en blogg? - va ser de ut som?
Vilken klass går du i? - 7an
Är du oskuld? - jao
Ditt favoritband? - One Direction LÄTT!!
Din favoritartist? - Eric :'') <33333
Thåström eller Håkan Hellström? - Håkan!!♥
Göteborg eller Stockholm? - stockholm
Vars bor du? - Fänbo
Vars vill du bo? - Gjorde inte jag den här listan nyss? :o jaja, valbo, Spanien elr nått..
Vilken låt är nummer 6 uppifrån i din spotifylista? - Celebration - Madona
Vilken låt är nummer 6 nedifrån i din spotifylista? - One day at a time - akon, enrique...blablaaa
Vem skrev åt dig på msn senast? - Cotten
Vem skrev du senast sms med? - Cotten
Vem ringde dig senast? - Vet inte.
Om du går in i ditt fotoalbum på mobilen, vad är det första du ser? - Eric! :D
Blind eller döv? - döv om jag måste välja
Har du MVG i något? Isåfall vad? - har inga betyg än.
Hur gammal tror du att du kommer bli? - tillräckligt! :)
Vad vill du jobba/jobbar som? - Inredare! :D
Var är dina syskon just nu? - Ute eller nere?
Senasta kändisen du såg? - Eric minälsklin Saade :*
Favoritkändis? - Eric :**
När åkte du bil i mer än 15 minuter senast? - När vi skjutsade Jenny
Har du piercingar? Isåfall, vars? - Men bara öronen, men snart naveln ;)
Vilken är den senaste låten som fastnat i ditt huvud? - All this way - Amanda Fondell
När grät du senast? - Igår natt..
Är du vig? - Nej.
Vad står det i ditt senast skickade sms och vem var det till? - "Film :D durå? :D" - cotten.
Använder du hårspray? - näpp
Vill du vara singel eller ha ett förhållande? - just nu, singel!
Har du varit tillsammans med två samtidigt? - nääe
Uppsatt hår eller hängande? - hängande
Vill du gifta dig i framtiden? - jag vet inte
Vilken vän vet mest om dig? - Agnes
Har du varit vän med någon som du inte tycker om nu? - japp
Vem skrev åt dig på Facebook senast? - Agnes
Vad stod det i din senaste händelse? - "Felx blbalbalba har komenterat inlägget i simons logg"
Vill du bli modell? - nä
Din bästa tjejkompis? - Agnes
Vad var det senaste du installerade på din dator? - ingenaning

Vem är den perversaste person du känner? - finns så måga så jag vet inte:)
Vad tittar du först på hos killar/tjejer? - utseende, JOO JAG HAR GJORT DEN HÄR LISTAN!! ja iaf! utseende (ögonen, smilet, haha ögonbrynen och håret!) jag vet inte, lite av allt! :D
Favoritdryck? - dricker ju inte läsk för tillfället.. men cola
Favoritdryck innehållandes alkohol? - cider.
Senaste CD-skivan du köpte? - Eric
Har du några plancher i ditt rum? På vem/vad? - 1 på Zac, två på Eric, 2 hästar (igarderoben) och 3 på Ulrik!:)
Vad ska du göra i sommar? - Sola, bada, INTE tappa shorts i sjön, kke åka till cypern, ha kul va med kompisar osv :)
Hur många har du strulat med på en kväll? - 1
Har du rökt på/knarkat? - nä
Hur ofta festar du? - Aldrig.
Favoritskådespelare? - Ingen aning om va han heter, men en annan då! Johnny Depp!
Favoritkomiker? - hahaha Robert! :D
Klänning eller kjol? - klänning
Har du varit med på TV? - japp
Vad kollar du helst för TV-program på morgonen? - vet inte
Snyggaste kändisen? - Eric!
Vart vill du resa innan du dör? - Hawaii kanske? :D

JAG ÄLSKAR SPÅKULAN

Hej Therese!

Du har en livlig fantasi och börjar bli medveten om hur snabbt dina känslor växlar beroende på vad och hur du tänker om en situation.



idag.

3 dagar sen, fan nu blev de fel "textstil" -.-

fast den här är ändå bäst! :D

IT'S FRIDAY, YEAH YOU KNOW IT!

DAGENS LOGISKA LÅT : Fredagsmys All Stars – Fredagsmys ;D

HAR MAN TRÅKIGT SÅ HAR MAN..

Spelade spel med morsan.. ist för att göra nått annat kul. no life. Just nu sitter Eric och stirrar ut mig! gulligt :')
;)

JAG GÖR INGENTING SOM ALLA ANDRA DAGAR DEN HÄR VECKAN!

seriöst jag får nå jävla utbrott! varför äre kallt ute?!  varför finns de ingenstans att gå i fänbo förutom fram?! man vill ju inte ens gå fram, då träffar man ju bara massa dryga folk! jag  är så jävla tjurig just nu! JAG HAR INTE GJORT NÅNTING DEN HÄR VECKAN OCH DE ÄR SISTA VECKAN PÅ LOVET!! HALLÅ! DE ÄR PÅ LOV MAN SKA VARA MED KOMPISAR, HA FILMKVÄLLAR, FLUMMA, OCH HA KUL! HAR JAG KUL?! NEJ. DE HAR JAG INTE, INTE ETT DUGG. alla kommer ba tänka "men chilla lite brunden.." eller "men du lär väl ringa nån kompis då om du vill ha kul." vafan om alla gör nått då?! om det bara finns två man har lust att vara med. och båda två gör nått annat! jag vet att jag inte ska blogga när jag är såhär tjurig! men när de inte finns nån annan att säga de till än mamma så är man ju så illa tvungen! åhh hejdå -.-
ge mig sommar!

NU GLÖMDE JAG JU SÄGA..

GLÖMDE JU SÄGA ATT VI HAR BESTÄLLT DEN DÄR VÄSKAN NU! :D DE VA DRF DE STOG "GLAD TJEJ!" PÅ FÖRRA INLÄGGET. MEN JAG FÅR DEN NÄR JAG FYLLER! ;D

GLADTJEJ!

Heej! :) eller gomorron ;) jag var faktiskt lite smart igår och ställde alarm på mobilen! Så 11 ringde de och jag vaknade! imon blir de väl 10.. jag tänker inte berätta om min natt, för den gick rätt så bra... kunde ju inte somna på engång som man alltid vill... men jag somnade rätt så tidigt. Nej jag ska inte ljuga.. när jag kollade på mobilen så var klockan halv 3 och jag la mig kvart i 2... fan att jag aldrig kan lägga mig i tid! de är ju bara tre dagar kvar :'c Fyfan va hemskt! Ni fattar inte hur tråkigt jag har haft typ hela den här veckan?! Har inte gjort NÅGOT ALLS!
Ge mig trettio grader varmt,
Palmer överallt,
En strand med bruna kroppar.
äh skit samma. JAAAAAAAAAAAAAAAAAAAAAG ÄR UTTRÅKAD! SKA INTE TRÅKA UT ER! HEJDÅÅ.



THERE'S AIN'T NOBODY WHO MAKES ME FEEL THIS WAY.


HAR MAN GLÖMT BORT SMAKEN, DÅ MIN VÄN ÄR DE DAGS!

Jag lära bara ta EN choklad bit och guuu va god den vaaar! :D men nu är de ju slut.. :(

JAG KOLLAR ALLTID PÅ DIN PROFIL BARA FÖR ATT JAG SAKNAR DIG!

Nu ska jag kolla på Big Mommas! grym! :D

HUR SKÖNT ÄR DET INTE ATT DUSCHA EGENTLIGEN?

Har precis duschat och smörjt in mig med body lotion. Hur skönt som helst! Nått som är lite sjukt är att jag har varit sjukt onyttig och druckit läsk hela veckan! Och nu känns de så jävla bra att jag dricker vatten! Bara en frukt sallad som saknas ;)
Jag har så sjukt tråkigt på dagarna, gör typ inget, går bara fram och tillbaka, kollar på tevä går till datorn osv. Inte alls kul! Så imon vill jag göra något riktigt kul! Om det hade varit sommar så hade jag lugnt legat och solat hela dagen och inte brytt mig i vad som händer i världen, bara jag får ligga på studsmattan/solstolen och sola! Det är verkligen sommar de! Ja men vi får se vad jag hittar på. kanske tar en promenad! Jamen vi hörs hörrni! :)
jag hatar min näsa. så fukking ful!

SITUPS!

Asså shit! vilken början det har blivit på min träning! igår började jag göra 10 armhävningar, 10 situs och 10 rygglyft.. eller var det i förrgår? skit samma. och nyss gjorde jag massa situps, vet inte hur många men de känns! ska göra nåra fler plus armhävningar och sen ska jag duscha! jag har ju sagt att jag ska göra 10 armhävningar, 10 situps och 10 rygglyft varje dag! och om jag gör det varje dag till sommarlovet då blire nog braa bra! sen när de blir mer vår oså, alltså när de är varmare då ska jag ju börja springa! men till de viktigaste (haha) mamma hade köpt en polka choklad! och jag sa att jag inte ville ha! blir lite förvånad själv. oså hällde jag ut colan! nu är jag taggad för beachbody! :D nu blire musik och fler situps :D

MÅSTE BLEKA HÅRET!

de är inte så blont som jag vill ha de :c jaja, har spelat massa spel på datorn i typ en halv timme - timme :$ oså dricker jag cola! så sjukt längesen! fan va gött! kanske ska kolla på nån film eller nått! eftersom att alla är så osociala o_______________o <--- val :D jaja bye!

DAGENS LÅT

DAGENS LÅT : The Hit Makers – 1, 2, 3, 4 (as made famous by Plain White T's)

TILLÅT MIG SMÅ LE.

HAHAHAHAAH ASSÅ NI MÅSTE SE DEN! JAG VET ATT DEN ÄR LITE LÅNG MEN 19 MINUTER... FAST ASSÅ BARA DOM SOM HAR SETT TWILIGHT! ALLTSÅ 1AN :D
http://www.youtube.com/watch?v=xDTZOFc4pA4
SÅÅÅ BRA! x''D NÄSTAN BÄTTRE ÄN FILMEN. NEEEJMEN :D KOLLA SÅ FATTAR NI VAD JAG MENAR MED RUBRIKEN ;)

DEN SKA BLI MIN!


JAG ÄR SÅ TRÖTT..

Hej!
Nu har jag haft problem att sova i kanske 6 nätter i rad! Jag får ju nå fel! äre månen? äre att sängen står åt fel håll? är min jävla klocka som tickar så jävla högt?! kan nån säga vafan de är!?! blir så jävla tjurig. plus att de förstör ju nästa dag oxå! jag orkar liksom ingenting.. jaja, jag blev iaf glad när jag kom ner idag! min bikini från Nelly hade kommit! :) provade den och den satt som ett smäck! spelade nyss GH. men de är ju inte så kul att spela i flera timmar. så jag vet inte riktigt vad jag ska göra nu! vill typ va med nån.. men orkar inte åka till nån. typ göra nått med nån.. sitta och prata och bara chilla. vet inte vad jag ska tänka på så jag blir glad heller.. fast jag är ju inte sur. jag är inte lessen, men jag är inte glad. jag är helt enkelt trött!
hejdå /trött tjej.

10 SANNINGAR OM MIG

1. Jag måste planera saker i för väg! annars känns de som att inget blir rätt..
2. Jag deppade alldeles för mycket 2011! hoppas de blir ändring på de!
3. Jag blir väldigt lätt tjurig och IBLAND väldigt lätt på humör igen!
4. Jag hatar snö.. men ibland är de bara för mysit!
5. Jag tror jag kommer stört (haha) grina när vi sitter på flyplatsen och väntar på planet som ska till cypern.. om de blir nått!
6. Jag är sån som vill ha allt som det alltid har varit!
7. Jag gillar en person just nu, och jag säger det varje gång men, det känns på ett helt annat sätt än alla andra killar.
8. Jag grinar varje gång vi ska åka utomlands, bara för att jag kommer sakna katterna, och pappa och tobias.. rätt så töntigt men jag är nog inte den enda! :)
9. När jag ska tänka måste det vara helt tyst!
10. Jag suger på matte!
Och det var 10 sanningar om mig, som nåra säkert redan visste! men det var väl intressant..? n-e-j. ;) jaja nu pratar jag i skype och ska snart sova! (: gonatt läsare!

MÅSTE BARA SÄGA!

ÅT SKIT GOD MAT IKVÄLL! FYFAAAN! KOTLETTER, KLYFTPOTATIS, BEA, VITSÅS OCH GRILLKRYDDA! DE ÄR JU PRICKEN ÖVER Iet :D
BARA FÖR ATT AGNES OCH JAG ÄR BÄST PÅ ATT LAGA MAT ;)

FILMFILMFILMFILM

Hejhej! :) kollade nyss på Bad teacher elr hur de nu stavas ;) den är ju bra rolig ibland xD jag säger typ hela tiden "vet inte riktigt vad jag ska göra nu" eller "jag ska nog bara chilla nu" men helt seriöst! jag chillar hela tiden! (: men ja nu ska jag chilla mera och lyssna på sjukt bra musik! :D kult att jag tog min spotify lista som en smily x'D ja jag är flumm :D:D:D:D:DDDDD
jusT nuE

TRUE

"you're ugly." k "you're fat" "k" I hate you." "k."Justin Bieber sucks." "BITCH YOU BETTER FUCKING RUN!"


HÅLLER DU I MIG, HÅLLER JAG I DIG.

Om det inte händer nått annat imon, så ska jag baka cupcakes! :) Nu dör jag om det inte blir mat snart!

MAN ÄR ALDRIG FÖR GAMMAL! ;)

Hej! jag hittade en bamse film på ica och kunde inte låta bli att köpa.. va så sjukt längesen jag såg den :') så jag kollade på den när jag kom hem sen kollade vi på Beacause I said so :) sjukt bra! (: nu ska jag chilla...lite mera :D
DAGENS LÅT : One Direction – Gotta Be You seriöst jag börjar nästan grina! fyfan va bra den ÄR! :'D
fyfan dehär skulle ju vara härligt! asså att sola! :D

OM DU HADE VARIT HÄR, DÅ HADE JAG SOVIT SOM ETT LITET BARN I EN STOR SÄNG.

Ska jag berätta om den här natten oxå?
Såhär började det : jag la mig så skönt på mina nya jätte sköna kuddar, tänkte på allt. men sen tänkte jag "nej nu måste jag sova!" så jag slog igen ögonen började tänka igen, försökte stoppa allt tänkande och bara sova. men tror ni det gick? N-E-J. jag bytte sida, låg rakt på ryggen, låg på mage, la mig emot väggen, la mig mot sängkanten.. inget funkade. jag låg och försökte sova i halvtimme - timme. nått sånt. tillslut bara somnade jag, som en liten säl. vaknade halv elva av att dom pratade nere, somnade om på engång och vaknade halv tolv ist! och nu sitter jag här. med ont i ögonen för att jag är så trött. jag kan ju liksom inte sova bort varje dag, men jag fattar liksom inte! jag somnade på engång första dagen jag hade vänt sängen, och andra och tredje, och sen så va allt förstört typ :o ikväll ska jag lägga mig 12-halv 1 vafan jag kan inte vara uppe till 2 halv 3 varje dag. men klockan liksom går jätte snabbt på kvällen-natten.
jaja, men jag vet faktiskt inte alls vad jag ska göra idag! ska handla med morsan nu iaf.. men vi hörs sen ;)
bild från i sommras när agnes fotade mig :)

GONATT ALLIHOPA


ZAYN MALIK = HOTTER THAN FIRE

omg! *dreglar* :D

DAGENS LÅT

DAGENS LÅT : George Shaid – Jag tror jag är kär sjukt länge sen jag hörde den! :D

SE PÅ MIG, JAG VILL HA DIG..

asså WTF!! filmen bara började om HELT random! :c trött jag blir. nu skiter jag i film ***********************.

2012 TO DO.

den sista är de mest MÅSTE på. de är ju måste på alla men måste med stora bokstäver på den sista! ;)

SEX AND THE CITY

Nu ska jag kolla på sex and the city 2. de är ju alltid gott att äta nått när man kollar på film så jag kanske ska poppa lite popcorn. när de är lov så vet jag ju inte riktigt vad det är för dag.. så jag gissar på att de är lördag ;) så jag tar en läsk oxå! nejmen de är väl tisdag? :o shit the same! nu drar jag! bye :)

OMG..

jag har gjort 1002 inlägg nu.. xD och när skaffade jag den här bloggen? april... nu tänkte jag stava de på spanska xD ja..jo men då kke de kan stämma.. xD men iaf de är sjukt mkt tycker jag då! bara för att jag ÖVER uppdaterar vissa dagar, och inget alls vissa dagar.. :) nu ska jag bara chilla på min sååå sköna säng! längtar redan tills de är dags att sova! kuddarna är bara FÖR sköna :D

WHOOOO!

Bög? Han har en flickvän
Ful? Miljontals tjejer tycker att han är den hetaste killen vid liv, och han är på miljontals affischer överallt?
Svag? Bröt foten på scenen och fortsatte sjunga.
Heartless? Lyssna på "Pray".
Misslyckad? 17 år gammal, 29 låtar, 4 album, 9 musikvideor, en film, 3 böcker, 20 utmärkelser, 2 turer, 86 visar, +400 miljoner fans. Gör detta som din status om du har respekt för Justin Bieber.

PUSS PÅ JUSTIN :*

Har nyss komit hem från en rejäl shopping! de blev två nya kuddar! påslakan, ett hjärta där de står SOV GOTT, taklampa, hårborste, tandborste, "duschsvamp", världens skönaste filt! men tyvärr inga mjukisar! dom fanns inte! men nästa vecka skulle dom komma in igen! :D

Sov gott Tessan! :)

MIN NATT..

gick och la mig vid två.. ja jag vet alldeles för sent nu när skolan börjar snart! iallafall. jag kunade verkligen inte somna! kuddarna var för hårda, de var för varmt, pappa snarckade JÄTTE HÖGT! och min dörr var halv öppen eftersom att fredde hade öppnat dörren.. kollade på mobilen och vad står det att klockan är? jo, 03:30 alltså halv fyra! jag blir tjurig på en gång och lägger tbx mobilen och vänder mig fram och tillbaka, sen tog jag ena kudden och låg och höll i den. sen slängde jag iväg den! till slut somnade jag.
Men de är inte slut än, imorse väckte morsan mig HALV 11 !!!!!!!! hur fan?! bara för att jag sa att jag skulle följa med till stan.. och nu vet jag inte hur jag ska göra.. om jag orkar? äh jag MÅSTE ha nya mjukisar! ja vi hörs senomjagöverleverstan!

BÖRJADE FAN GRINA..

jag började fan grina! fan vilka jävla idioter!! hur fan kan man göra såhär mot en HUND?! asså jag tycker mer synd om djur än om människor! FYFAAAN!!! blir så jävla arg när nått sånt här händer! jävlafelknulladeungjävlar!

INTE RIKTIGT MIN GREJ MED FLÄTOR..

fan va ful de blev! hade tänkt börja ha flätor/en fläta, så jag slipper slita ut håret med min jävla plattång.. men jag vet inte riktigt vad jag tycker om min ide.. måste verkligen lära mig göra vanliga flätor och inbakade på andra och mig själv.. fan. jag är inte trött.. klockan är snart två och morsan väcker mig 11 imon :o nämnde jag att jag vaknade 1 idag?! ;o jaja, vi hörs imon om jag överlever att kliva upp 11 ;)

JAG INSÅG DE NYSS! OH MY GOD!

JAG INSÅG NYSS ATT DE ÄR GABRIEL BRANDES (SOMFÖLJERMIGPÅTWITTER) SJUNGER Gabriel Brandes – You - Radio Edit VAFAAAAN!!! JAG KOM PÅ DE NU ALLDELES NYSS! OH MY FUCKIN' GOD! JAG DÖÖÖR!! :'''''''D <333333333333 ÅHHHH FAN VA GLAD JAG ÄR!!! :D
SÅHÄR JÄVLA GLAD ÄR JAG JUST NU! FAST DEN HÄR BILDEN ÄR JU FRÅN I SOMMRAS MEN SAME SHIIT!!! :DDD

ENA DAGEN HAR MAN 15 LÄSARE OCH ANDRA 5...?

va händer? :o fortsätt läsa! :D

DON'T STOP BELIEVIN'

Den här låten förändrade hela minn kväll och mitt humör :) Journey – Don't Stop Believin' nyss var mitt humör på lägsta deppet..! och nu är de på väg till toppen igen! ;)
hur EN person kan förändra ALLT.

I ♡ U

åhh flumm jag ÄR!! :D imon ska jag till sandviken och valbo ;) måste köpa nya mjukisar, vi ska typ skjutsa Jenny till tåget :) jaja, men vi hörs sen! (:

DAGENS RANDOM..

jag blir kissnödig till den här låten.. Twilight Orchestra – Bella's Lullaby x'''D

THE WAY YOU LOOK AT ME, I HAVE NEVER SEEN THAT LOOK BEFORE.

No, I don't wanna fight it, I don't wanna hide the way i feel.
So I guess it's time for me to say..
That I got eyes for you baby, I want us to be together.

DAGENS LÅT

DAGENS LÅT : Tom Pulse – Cuando - Sunshine Radio Mix
Duschade för ett tag sen! och nu har jag gjort förrätt! hoppas de blir gott.. ;) imon vet jag inte alls vad jag ska göra.. bara sitta hemma och tröka..

I THINK I'M FALLIN FOR YOU.

Hejsaaan! vaknade kvart över 1.. vaknade mitt i natten med ett kick.. drömde typ om spindlar :s jaja, nu kollar jag, jenny och tobias på en film! hörs! :)

:')

DAGNES LÅT : http://www.youtube.com/watch?v=qJQZMXbj6es äre bara jag som inte vet hur man gör så att de blir så att låten kommer upp i inlägget på engång?! :o fan de är ju fult med massa länkar! men nu ska jag sova! gonatt my darlings! (:
VARNING! En anka i bilden..

VILKEN ÅNGEST JAG KOMMER HA IMON/IDAG..

ajaa.. de är jullov så de spelar fan ingen roll.. och de är BARAAA!!!! en vecka kvar :''''''''''''(
gonatt, om jag inte skriver mer.

HADE DET VARIT SOMMAR OCH INTE SÅ MÖRKT SÅ..

SÅ HADE JAG GÅTT UT OCH SJUNIGT NU!!!! FAN VA KUL, BARA GÅ RUNT O SKRIVA (SJUNG-SKRIKA) "HEEEEEEEEEEEEELT GAAAAAAAAAAAAALEEEEEEEEEEEN GAAAAAAALEN IIIIII DIIIIIIIIIIIIIIIIIIIG!!!!!!!!!!!!!!!! JAAAAAAAAA ATT VARA FÖR ÄÄÄÄÄÄÄÄLSKAD!! DE MÅSTE KÄNNAS SÅÅÅÅÅÅÅÅÅÅÅÅÅHÄÄÄÄÄÄÄÄÄÄÄR!!! NU ÄR JAG HELT GALEN I DIG I DITT HIMELSKA LEENDE I DITT SKRATT! HELT GAAAAAAAAAAAAALEEEEEEEN!!"

VAFAN ÄRE INGEN SOM ÄR VAKEN?!

vafan de är inte många inne på msn och en på skype?! vafan är de här?! :o klockan är fan va kvart i ett! jag sitter bara och chillar, lyssnar pånyårslistan! som är hur kung som helst! :D lite sådär flumm oxå :D men tjarrå alla sovande jävlar! :D

SEX AND THE CITY, HELL YEAH!


FÖLJ MIG PÅ BLOGLOVIN

http://www.bloglovin.com/blog/2509306/tessanduvet

BARA 46 saker..

‎46 saker en tjej vill ha men inte vågar be om ♥
Killar läs och lär!
1. Håll om henne runt midjan
2. Försök verkligen att prata med henne
3. Dela hemligheter med henne, men håll dem för dig själv
4. Erbjud henne din jacka om det är kyligt
5. Kyss henne långsamt
6. Krama henne mjukt
7. Håll om henne nära ditt bröst
8. Skratta med henne
9. Bjud ut henne någonstans
10. Umgås med hennes och dina vänner tillsammans
11. Ler hon vill hon att du ska le tillsammans med henne
12. Ta bilder med henne, en bild säger mer än tusen ord..
13. Låt henne sitta i ditt knä
14. När hon säger att hon älskar dig mer, förneka det. Hon vill höra att du älskar henne mest
15. När hennes vänner säger att de älskar henne mer. Förneka det, håll om henne hårt framför hennes vänner, det får henne att känna sig älskad
16. Lek med dina fingrar i hennes hår
17. Kyss henne då hon minst anar det
18. Krama henne bakifrån och håll om henne runt midjan
19. Berätta för henne hur vacker hon är
20. Berätta hur du känner för henne, hon vill höra det hur många gånger du än sagt det förr
21. Öppna dörren, följ henne fram till dörren/bilen. Hon känner sig trygg och du anses vara en gentleman
22. Berätta att hon är ditt allt – BARA om du verkligen menar det
23. Om du märker att något är fel, fråga. Förnekar hon det så håll bara om henne utan att säga ett ord. Hon förstår då att du alltid finns där, oavsett vad
24. Få henne att känna sig älskad
25. Kysser du henne framför andra tjejer, då inser hon att hon är den enda som betyder något i din närvaro
26. Det värsta som finns är om du ljuger för henne. Berätta sanningen, även fast den kan svida ibland
27. Behöver jag ens nämna att du INTE ska vara otrogen?
28. Ta henne till en plats hon verkligen gillar
29. Smsa eller ring henne på kvällen och berätta hur mycket du saknar henne
30. Se till att alltid finnas där för henne. Även om hon inte behöver det just då, så mår hon bättre av att veta att du finns för henne alla tider på dygnet
31. Håll henne tätt intill dig när det är kallt, då kan hon även hålla om dig
32. När du är ensam, håll henne nära och kyss henne
33. Kyss henne lätt på kinden eller i pannan (det kommer ge henne en vinkel av att du vill känna hennes läppar mot dina)
34. Även i filmer, lägg din arm om hennes axel och hon lägger automatiskt sitt huvud mot din axel. Luta upp hennes huvud och kyss henne
35. Lämna henne ALDRIG på skämt eller var arg på henne. Om hon är upprörd, trösta henne
36. När andra människor dissar henne, stå upp för henne
37. Titta henne djupt i ögonen och säg att du älskar henne
38. Lägg er och kolla på stjärnorna och låt henne vila sitt huvud på ditt bröst och låt henne lyssna på dina hjärtslag.
39. Se till att det är du som tar första steget och tar henne i handen när ni är i stan. Hon vet då att du inte skäms för att visa att hon är din!
40. Försök hålla om henne så länge som möjligt när du kramar henne
41. Ring eller smsa och berätta hur mycket hon betyder. Men självklart inte för ofta. Det kan bli jobbigt att höra det vare dag!
42. Trösta henne när hon gråter. Torka bort hennes tårar och håll henne tätt intill dig
43. Ta med henne på långa promenader på kvällarna
44. Påminn henne alltid hur mycket du älskar henne. Hon tröttnar aldrig på dina ord
45. Tjejerna kanske förnekar det, men de älskar när du kittlar dem!
46. Hon vill att du läst igenom hela denna listan och tagit åt dig det mesta. Tro mig

HJÄRTAT VÄLJER BLINT.


HAHA...


HEADER

Har börjat gjort en ny header! men måste ändra storlek på den -.- orkar inte göra de nu! men jag blev inte jätte nöjd med den.. men de får duga! nu ska jag äta glass! :)
såhär ser jag ut dagen efter. sjukt trött! fast vi sov till 1.. lite för ful för att visas på bild! BYE!

NYÅR

lite från igår, orkade inte lägga ut alla bilder! va lite misslyckade raketer oxå, oså när agnes och jag flummar. vi är ju otroligt snygga på alla dom här bilderna oxå! vi hade sjukt kul iaf! hög musik o flumma! :)

2012

Hur har ditt 2011 varit?
bra och dåligt!
Blev du kär i år?
Ja!
Vad önskar du att du gjort mer?
ridit.
Vad önskar du att du gjort mindre?
Deppat.
Vem har du umgåtts med mest?
agnes
Bästa minnet från 2011?
Spanien!
Är det något du kommer sakna 2011 som du vill ha år 2012?
Spanien!
Var du gladare eller ledsnare i år jämfört med tidigare år?
typ lika.
Var det mest lugna hemmakvällar eller vilda partykvällar?
lugna hemma kvällar! :)
Vem/Vilka saknade du?
pass.
Största misstaget?
en person.
Tror du att år 2012 kommer blir bättre?
jaa! de hoppas jag!
Vad gjorde dig riktigt glad i år?
de här året har bara varit en dag.. xD
Hur många kysste du? 
3..
Har du några löften inför år 2012? 
jaa..!
Har du haft ett förhållande under 2011? 
jaa.. 
Hur skulle du beskriva din stil 2011? 
vet inte.
Vart reste du nånstans? 
Spanien och England!
Vad ser du mest fram emot med år 2012?

Sommaren! :D


RSS 2.0